(주) 코아사이언스 Coresciences Inc.

안녕하세요! Gene Tools 수입/공급 업체 코아사이언스 입니다. 자세한 상품 정보 및 관련 문의는 전화 02-858-0328 또는 info@coresciences.co.kr로 문의주시기 바랍니다. 감사합니다! Clawed frog p53 Oligo Xenopus laevis p53 oligo Cat.# Size M.W. PCO-ClawedFrogP53-100 100nmol 8500.00 This is a Morpholino oligo targeting Xenopus laevis p53. Oligo sequence: GCCGGTCTCAGAGGAAGGTTCCATT Molar Absorptivity: 256200.00 * 본 상품은 오직 연구용으로만 사용 가능합니다. 인체 및 제품화에 사용하실 수 없습니..

안녕하세요! Gene Tools 수입/공급 업체 코아사이언스 입니다. 자세한 상품 정보 및 관련 문의는 전화 02-858-0328 또는 info@coresciences.co.kr로 문의주시기 바랍니다. 감사합니다! Clawed Frog Beta Catenin Positive Control Oligo Xenopus laevis Beta Catenin antisense oligo Cat.# Size M.W. PCO-BetaCatenin-100-F 100nmol 8901.00 This carboxyfluoresceinated Morpholino oligo targets the Xenopus laevis Beta Catenin gene. This oligo acts as a positive control for..

안녕하세요! Gene Tools 수입/공급 업체 코아사이언스 입니다. 자세한 상품 정보 및 관련 문의는 전화 02-858-0328 또는 info@coresciences.co.kr로 문의주시기 바랍니다. 감사합니다! Zebrafish Chordin Positive Control Oligo Danio rerio Chordin positive control oligo Cat.# Size M.W. PCO-ZebrafishChordin-100-F 100nmol 8742.00 This carboxyfluoresceinated Morpholino oligo targets the Danio rerio Chordin gene. This oligo acts as a positive control for knockdown ..

안녕하세요! Gene Tools 수입/공급 업체 코아사이언스 입니다. 자세한 상품 정보 및 관련 문의는 전화 02-858-0328 또는 info@coresciences.co.kr로 문의주시기 바랍니다. 감사합니다! Zebrafish p53 oligo Danio rerio apoptosis suppression oligo Cat.# Size M.W. PCO-ZebrafishP53-100 100nmol 7804.00 This is a Morpholino oligo targeting zebrafish p53, reported to suppress apoptotic effects induced by some Morpholinos (Robu et al. 2007, PLoS Genetics). Oligo seque..

안녕하세요! Gene Tools 수입/공급 업체 코아사이언스 입니다. 자세한 상품 정보 및 관련 문의는 전화 02-858-0328 또는 info@coresciences.co.kr로 문의주시기 바랍니다. 감사합니다! Random Control Oligo 25-N 25-base random sequence mixture Cat.# Size M.W. PCO-RandomControl-25N-100 100nmol 8463.00 These 25-base mixed oligos are synthesized with a random base mixture at every position. They are intended for use as a negative control. The concentration of any..

안녕하세요! Gene Tools 수입/공급 업체 코아사이언스 입니다. 자세한 상품 정보 및 관련 문의는 전화 02-858-0328 또는 info@coresciences.co.kr로 문의주시기 바랍니다. 감사합니다! Standard Control Oligo Cat.# Size End-Modification M.W. PCO-StandardControl-100 100nmol - 8328.00 PCO-StandardControl-100-F 100nmol 3' Fluorescein 8817.00 PCO-StandardControl-100-L 100nmol 3' Lissamine 9112.00 PCO-StandardControl-100-GB 100nmol 3' Gene Tools Blue 9078.00 PCO-St..

안녕하세요! Gene Tools 수입/공급 업체 코아사이언스 입니다. 자세한 상품 정보 및 관련 문의는 전화 02-858-0328 또는 info@coresciences.co.kr로 문의주시기 바랍니다. 감사합니다! Vivo-Morpholino Standard Control Oligo Cat.# Size PCO-VivoStandardControl-100 100nmol Our standard control oligo is a negative control Morpholino oligo that targets a human beta-globin intron mutation that causes beta-thalassemia. Short Description: Negative Vivo-Morpholino con..

안녕하세요! Gene Tools 수입/공급 업체 코아사이언스 입니다. 자세한 상품 정보 및 관련 문의는 전화 02-858-0328 또는 info@coresciences.co.kr로 문의주시기 바랍니다. 감사합니다! Endo-Porter DELIVERY OF MORPHOLINO OLIGOS Cat.# Product Size OT-EP-PEG-1 Endo-Porter (PEG) 1ml OT-EP-DMSO-1 Endo-Porter (DMSO) 1ml OT-EP-AQ-1 Endo-Porter (Aqueous) 1ml Endo-Porter is a reagent for delivering Morpholino oligos, peptides or proteins into the cytosol of cultured c..