티스토리 뷰

실험.연구용 추천상품

[Prepared Control Oligos] Vivo-Morpholino Standard Control Oligo [PCO-VivoStandardControl-100]_Gene Tools - 코아사이언스

코피디 2022. 3. 21. 11:14

안녕하세요!

Gene Tools 수입/공급 업체 코아사이언스 입니다.

 

자세한 상품 정보 및 관련 문의는 전화 02-858-0328 또는 info@coresciences.co.kr로 문의주시기 바랍니다.

감사합니다!

Vivo-Morpholino Standard Control Oligo

Cat.#                                                   Size         

PCO-VivoStandardControl-100        100nmol   

Our standard control oligo is a negative control Morpholino oligo that targets a human beta-globin intron mutation that causes beta-thalassemia.


Short Description: Negative Vivo-Morpholino control oligo

Oligo sequence: CCTCTTACCTCAGTTACAATTTATA

 

Molar Absorptivity: 259160.00 

Molecular Weight: 10138.00

 

* 본 상품은 오직 연구용으로만 사용 가능합니다. 인체 및 제품화에 사용하실 수 없습니다.

코아사이언스 coresciences Gene Tools, LLC CustomMorpholino PreparedControlOligos Delivery Tools Vivo-Morpholino Morpholino antisense oligos Morpholino oligo siRNA gene inhibition 한국 대리점

저작자표시 비영리 변경금지

'실험.연구용 추천상품' 카테고리의 다른 글

[Prepared Control Oligos] Random Control Oligo 25-N [PCO-RandomControl-25N-100]_Gene Tools - 코아사이언스  (0) 2022.03.21
[Prepared Control Oligos] Standard Control Oligo - Negative control Morpholino oligo [PCO-StandardControl]_Gene Tools - 코아사이언스  (0) 2022.03.21
[ENDO-PORTER DELIVERY OF MORPHOLINO OLIGOS] Endo-Porter (PEG) [OT-EP-PEG-1], Endo-Porter (DMSO) [OT-EP-DMSO-1], Endo-Porter (Aqueous) [OT-EP-AQ-1]_Gene Tools - 코아사이언스  (0) 2022.03.21
[PCR/qPCR 튜브/8-스트립 튜브 스핀다운용 미니 원심분리기 토토] Torto Mini-Centrifuge [GSI001/TORTO]_Gunster Biotech - 코아사이언스  (0) 2022.03.17
IBA Lifesciences GmbH - 수입/공급 전문 코아사이언스  (0) 2022.03.16