티스토리 뷰
[Prepared Control Oligos] Standard Control Oligo - Negative control Morpholino oligo [PCO-StandardControl]_Gene Tools - 코아사이언스
코피디 2022. 3. 21. 11:24안녕하세요!
Gene Tools 수입/공급 업체 코아사이언스 입니다.
자세한 상품 정보 및 관련 문의는 전화 02-858-0328 또는 info@coresciences.co.kr로 문의주시기 바랍니다.
감사합니다!
Standard Control Oligo
Cat.# Size End-Modification M.W.
PCO-StandardControl-100 100nmol - 8328.00
PCO-StandardControl-100-F 100nmol 3' Fluorescein 8817.00
PCO-StandardControl-100-L 100nmol 3' Lissamine 9112.00
PCO-StandardControl-100-GB 100nmol 3' Gene Tools Blue 9078.00
PCO-StandardControl-300 300nmol - 8328.00
PCO-StandardControl-300-F 300nmol 3' Fluorescein 8817.00
PCO-StandardControl-300-L 300nmol 3' Lissamine 9112.00
Our standard control oligo is a negative control Morpholino oligo that targets a human beta-globin intron mutation that causes beta-thalassemia.
Short Description: Negative control oligo
Oligo sequence: CCTCTTACCTCAGTTACAATTTATA
Molar Absorptivity: 259160.00
* 본 상품은 오직 연구용으로만 사용 가능합니다. 인체 및 제품화에 사용하실 수 없습니다.
코아사이언스 coresciences Gene Tools, LLC CustomMorpholino PreparedControlOligos Delivery Tools Vivo-Morpholino Morpholino antisense oligos Morpholino oligo siRNA gene inhibition 한국 대리점
'실험.연구용 추천상품' 카테고리의 다른 글
- Total
- Today
- Yesterday
- 바이오헤저드백
- 콘드로이틴 황산 올리고당
- 연속절편
- allview PAGE buffer
- 후나코시
- 면역화학분석
- gradient gel
- 미니멸균백
- 조직염색절편제작
- time release pellets
- 막필터
- material science
- Coresciences
- 조직절편제작
- Funakoshi
- matrix-driven delivery pellet
- OLED
- OPV
- 바이오하자드백
- 건스터바이오텍
- solar cells
- Sterlitech
- 고수용성 콘드로이틴
- 형광염색
- 조직절편
- 파라핀 블록
- 파라핀 블럭
- 코아사이언스
- 오토클레이브백
- filter
일 | 월 | 화 | 수 | 목 | 금 | 토 |
---|---|---|---|---|---|---|
1 | ||||||
2 | 3 | 4 | 5 | 6 | 7 | 8 |
9 | 10 | 11 | 12 | 13 | 14 | 15 |
16 | 17 | 18 | 19 | 20 | 21 | 22 |
23 | 24 | 25 | 26 | 27 | 28 |