실험.연구용 추천상품

[Prepared Control Oligos] gal4-uas Morpholino Oligo [PCO-gal4-100]_Gene Tools - 코아사이언스

코피디 2022. 3. 21. 12:00

안녕하세요!

Gene Tools 수입/공급 업체 코아사이언스 입니다.

 

자세한 상품 정보 및 관련 문의는 전화 02-858-0328 또는 info@coresciences.co.kr로 문의주시기 바랍니다.

감사합니다!

gal4-uas Morpholino Oligo 

gal4-uas Morpholino oligo

Cat.#                     Size            M.W.      

PCO-gal4-100        100nmol       8507.00

 

This Morpholino oligo is a translation blocker targeting the gal4-UAS (Upstream Activation Sequence). This oligo targets the most frequently used gal4-UAS sequence and has been validated in Tallafuss et al.

 

Oligo sequence: GTTCGATAGAAGACAGTAGCTTCAT

 

Molar Absorptivity: 266090.00

 

* 본 상품은 오직 연구용으로만 사용 가능합니다. 인체 및 제품화에 사용하실 수 없습니다.

코아사이언스 coresciences Gene Tools, LLC CustomMorpholino PreparedControlOligos Delivery Tools Vivo-Morpholino Morpholino antisense oligos Morpholino oligo siRNA gene inhibition 한국 대리점