실험.연구용 추천상품

[Prepared Control Oligos] Green Fluorescent Protein Positive Control [PCO-GFPControl-100]_Gene Tools - 코아사이언스

코피디 2022. 3. 21. 11:56

안녕하세요!

Gene Tools 수입/공급 업체 코아사이언스 입니다.

 

자세한 상품 정보 및 관련 문의는 전화 02-858-0328 또는 info@coresciences.co.kr로 문의주시기 바랍니다.

감사합니다!

Green Fluorescent Protein Positive Control

Translation blocker for GFP target

Cat.#                              Size            M.W.      

PCO-GFPControl-100         100nmol      8275.00

 

This Morpholino is a translation blocker targeting the first 25 bases of the coding sequence of one version of green fluorescent protein (GFP).

 

Oligo sequence: ACAGCTCCTCGCCCTTGCTCACCAT

 

Molar Absorptivity: 246420.00

 

* 본 상품은 오직 연구용으로만 사용 가능합니다. 인체 및 제품화에 사용하실 수 없습니다.

코아사이언스 coresciences Gene Tools, LLC CustomMorpholino PreparedControlOligos Delivery Tools Vivo-Morpholino Morpholino antisense oligos Morpholino oligo siRNA gene inhibition 한국 대리점