[Prepared Control Oligos] Vivo-Morpholino Standard Control Oligo [PCO-VivoStandardControl-100]_Gene Tools - 코아사이언스
안녕하세요!
Gene Tools 수입/공급 업체 코아사이언스 입니다.
자세한 상품 정보 및 관련 문의는 전화 02-858-0328 또는 info@coresciences.co.kr로 문의주시기 바랍니다.
감사합니다!
Vivo-Morpholino Standard Control Oligo
Cat.# Size
PCO-VivoStandardControl-100 100nmol
Our standard control oligo is a negative control Morpholino oligo that targets a human beta-globin intron mutation that causes beta-thalassemia.
Short Description: Negative Vivo-Morpholino control oligo
Oligo sequence: CCTCTTACCTCAGTTACAATTTATA
Molar Absorptivity: 259160.00
Molecular Weight: 10138.00
* 본 상품은 오직 연구용으로만 사용 가능합니다. 인체 및 제품화에 사용하실 수 없습니다.
코아사이언스 coresciences Gene Tools, LLC CustomMorpholino PreparedControlOligos Delivery Tools Vivo-Morpholino Morpholino antisense oligos Morpholino oligo siRNA gene inhibition 한국 대리점